• Users Online: 12
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe News Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 3  |  Issue : 1  |  Page : 7-14

The role of Val66Met single nucleotide polymorphism in brain-derived neurotropic factor gene in prediction of adverse outcomes after ST-segment elevation myocardial infarction


1 Department of Prevention and Treatment of Emergency Conditions, “L. T. Malaya Therapy National Institute NAMSU”, Kharkiv, Ukraine
2 Department of Internal Medicine, Therapeutic Unit, State Medical University of Zaporozhye, Zaporozhye, Ukraine
3 Department of Clinical, Social and Child Psychiatry, Institute of Neurology, Psychiatry and Narcology of the National Academy of Medical Sciences of Ukraine; Department of Clinical Neurology, Psychiatry and Narcology, V. N. Karazin's Kharkiv National University, Kharkiv, Ukraine

Date of Submission23-Aug-2019
Date of Acceptance25-Sep-2019
Date of Web Publication12-Nov-2019

Correspondence Address:
Prof. Alexander E Berezin
Department of Internal Medicine, Therapeutic Unit, State Medical University of Zaporozhye, 26, Mayakovsky av., Zaporozhye, UA-69035
Ukraine
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/hm.hm_40_19

Rights and Permissions
  Abstract 

Background: The single nucleotide polymorphism of Val66Metgen of the brain-derived neurotrophic factor (BDNF) gene is a possible candidate that is associated with the development of psychopathology and combines it with cardiovascular events. The purpose of this study was to research the possible associations of single-nucleotide polymorphism of Val66Met BDNF gene with the occurrence of endpoints after 6 months of follow-up after ST-segment elevation myocardial infarction (STEMI). Materials and Methods: 256 acute STEMI patients after successful primary percutaneous coronary intervention (PCI) were enrolled in the study. Thrombolysis in myocardial infarction III blood flow restoring through culprit artery was determined. The study of single-nucleotide polymorphism of Val66Met gene BDNF (rs6265) was performed by real-time polymerase chain reaction. The emotional state of the patients and its relationship with stress were assessed with the questionnaire “Depression, Anxiety, and Stress-21”. Results: The frequency of genotypes Val66Met gene for BDNF in STEMI patients (n = 256) was the following: 66ValVal = 74.2% (n = 190), 66ValMet + 66MetMet - 25.8% (n = 66). The 66ValMet + 66MetMet polymorphism in the BDNF gene, stress, and anxiety on 10–14 days before the event, as well as reduced left ventricular ejection fraction, were independently associated with combined 6 months' clinical endpoint after STEMI. Conclusion: The Val66Met polymorphism in BDNF gene was found as an independent predictor for combined 6-month clinical endpoints after acute STEMI-treated primary PCI.

Keywords: Brain-derived neurotrophic factor, outcomes, single nucleotide polymorphism Val66Met, ST-segment elevation myocardial infarction


How to cite this article:
Petyunina OV, Kopytsya MP, Berezin AE, Skrynnyk OV. The role of Val66Met single nucleotide polymorphism in brain-derived neurotropic factor gene in prediction of adverse outcomes after ST-segment elevation myocardial infarction. Heart Mind 2019;3:7-14

How to cite this URL:
Petyunina OV, Kopytsya MP, Berezin AE, Skrynnyk OV. The role of Val66Met single nucleotide polymorphism in brain-derived neurotropic factor gene in prediction of adverse outcomes after ST-segment elevation myocardial infarction. Heart Mind [serial online] 2019 [cited 2022 Dec 9];3:7-14. Available from: http://www.heartmindjournal.org/text.asp?2019/3/1/7/270770


  Introduction Top


Cardiovascular (CV) diseases and depression are mutually relating disorders. Depression and stress increase the risk of death after CV event 2–4 times.[1] Recent researches focus on the study of homeostasis between the central nervous system and CV system. There were presented the mechanisms by which psychological stress enhanced the risk of CV events (complications of coronary atherosclerosis, endothelial dysfunction, inflammation, and deterioration of fibrinolysis).[2] Moreover, the neuropoietic properties of the neurotrophins super family can be modified by the traditional CV risk factors and pro-inflammatory activation.[3]

Neurotrophins are a family of regulatory proteins that play a pivotal role in the proliferation, differentiation, survival, and plasticity of both central and peripheral neurons. The brain-derived neurotrophic factor (BDNF) is the most studied and important neurotrophin protein that causes proliferation, survival of cholinergic, serotonergic, and dopaminergic neurons. BDNF deficiency reduces neurons plasticity, disrupts memory and learning ability, and cognitive function.[4],[5] It trigs an activation of nuclear factor kB (NF-kB) receptors that lead to the endothelial cell survival and neoangiogenesis.[6],[7],[8] In the embryonal period, BDNF deficiency worsens the myocardial vessel development.[9] BDNF is able to regulate of blood flow in ischemic tissue and improve left ventricular (LV) function after ischemic injury.[7],[8],[9],[10] There is evidence that replacement valine to methionine at codon 66 (Val66Met) pro-BDNF molecule affects the intracellular processing and declines secretion of BDNF increasing a risk of depression and suppressing susceptibility to ischemia.[11] The aim of the study was to investigate association between single nucleotide polymorphism (SNP) Val66Met in BDNF gene and combined 6-month clinical endpoints after acute ST-segment elevation myocardial infarction (STEMI).


  Materials and Methods Top


Patients' population

A total of 320 patients with confirmed acute STEMI were analyzed for participation in the study [Figure 1]. From entire population of STEMI (n = 320) according to inclusion and noninclusion criteria, it was enrolled 256 acute STEMI individuals that were admitted to intensive care unit of “L.T. Malaya TNI NAMSU” within a given period from 2016 August to 2019 February. Acute STEMI was diagnosed according to ECS Guidelines (2017).[12] Inclusion criteria were established acute STEMI, age >18 years of age, and a lack of contraindications to percutaneous coronary intervention (PCI). Exclusion criteria were previous myocardial infarction (MI), established chronic heart failure (HF), known malignancy, severe comorbidities (anemia, chronic obstructive lung disease, bronchial asthma, liver cirrhosis, chronic kidney disease, valvular heart disease, and bleeding), and inability to understand of informed consent.
Figure 1: Study design flow chart. MACE = Major adverse cardiac events

Click here to view


Primary percutaneous coronary intervention

Primary PCI with bare-metal stent (COMMANDER, “Alvimedica,” Turkey) implantation in culprit artery was performed in 181 patients. In addition, the patients underwent complete revascularization using implantation of 1–4 stents onto ischemic-related arteries. Seventy-five patients were previously treated with primary thrombolysis (tenecteplase and alteplase) before an admission to the hospital with followed PCI during 6–12 h after initial acute STEMI confirmation. Tenecteplase (Metalise, Boehringer Ingelheim Pharma, Germany) or Alteplase (Actilyse, Boehringer Ingelheim Pharma, Germany) were used in adjusted doses for thrombolysis. Thrombolysis in MI III blood flow restoring through culprit artery was determined for all enrolled patients with acute STEMI. [Figure 2] reported appropriate steps of PCI in acute STEMI patients who were enrolled in the study. All acute STEMI patients received adjuvant treatment due to current ESC recommendations.[12]
Figure 2: The steps of PCI procedure that illustrate TIMI -III blood flow restoring. The results of PCI in patient enrolled in the study. (a-c) white arrow indicates culprit coronary artery lesion (circumflex coronary artery stenosis 92%). (d-f) PCI with BMS: white arrow indicates place for positioning BMC = Bare metal stent and restoring of TIMI-III blood flow. PCI = Percutaneous coronary intervention, TIMI = Thrombolysis in myocardial infarction

Click here to view


Ethical declaration

All procedures performed in the study involving human participants were in accordance with the ethical standards and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards and approved by the local ethics committee (Protocol Number. 8, August 29, 2016). Written inform consent was obtained from each patient.

Sample size calculation

The sample size was calculated through the effect size estimation (0.99), the type of present study, providing study power of 80% and type I error 5%, in-hospital mortality of 7%, and 1-year mortality of 14%.[13] The sample size was 250 individuals.

Coronary angiography

Conventional coronary angiography was performed immediately after admission of the patients to the hospital using Digital X-ray system “Integris Allura” (Philips Healthcare, Best, The Netherlands) and managed by radial or femoral vascular access. Coronary arteries were visualized with two-to-three orthogonal projections per conventional protocol. In this study, the contrast “Ultravist-370” (Baier Pharma GmbH, Germany) and automatic contrast injector were used. The contrast amount used in coronary angiography in each injection was 8–10 mL at 4 mL/s for the left coronary artery and 6 mL at 3 mL/s for the right coronary artery (radiation exposure 20–35 mGycm). The number of views obtained was decided by the operator depending on coronary anatomy.

Determination of risk factors and comorbidities

Hypercholesterolemia (HCE) was diagnosed if total cholesterol (TC) level was above 5.2 mmol/L, and/or low-density lipoprotein (LDL) cholesterol level was above 3.0 mmol/L, and/or level of triglycerides (TG) was above 1.7 mmol/L according to European Cardiology Society Dyslipidemia Guideline (2016).[14] Hypertension was diagnosed if systolic blood pressure (SBP) was >140 mmHg and/or diastolic blood pressure (DBP) >90 mmHg according to European guideline on diagnostics and treatment of arterial hypertension (2018).[15]

Echo examination

Echo-CG performed on “Aplio 500” (TUS-A500) Toshiba Medical Systems Corporation with usage of 3.5 MHz phase probe at discharge and at 6-month observation period. LV end-diastolic volume, LV end-systolic volume, and LV ejection fraction (LVEF) measuring were done according to Simpson's method per contemporary recommendation. Left atrium diameter and left atrium volume were determined too. LV myocardial mass was calculated in automatic manner per protocol of echocardiograms evaluation. LV global longitudinal strain (e') and early transmitral velocity (E) were measured by tissue Doppler imaging technique and impulse transmitral Doppler regimen at baseline and at 6 months per protocol.

Determination of endpoints

The primary endpoint was combined event (follow-up major adverse cardiac events – MACEs and hospitalization) that occurred within 6 months of the discharge from the hospital. MACEs were defined as the composite of CV death, recurrent angina, and newly diagnosed HF. CV death was ascertained by personal or phone contacting the family doctor or the hospital where the patient died. The diagnosis of recurrent angina required the presence of clinical signs/symptoms or electrocardiographic changes. The diagnosis of HF de novo has been established according to ESC clinical guideline.[16] Hospitalization was ascertained by direct or phone contact with the hospital reception where the patient was admitted.

Blood samples

Blood samples were drawn immediately before PCI and at 6 months after acute STEMI. Blood samples were centrifuged, serum was isolated within 30 min of sample acquisition, and after then, they were freezed with − 70°C and stored in plastic tubes until being shipped to the laboratory of immunochemical and molecular-genetic researches of “L.T. Malaya TNI NAMSU.”

Troponin I (Tn I) level measuring was performed with chemoluminescent immunoassay (Humalyser 2000, Mannheim, Germany). The TnI level average was 0.5–50 ng/mL.

TC, LDL cholesterol, high-density lipoprotein cholesterol, and TG were measured direct enzymatic method (Roche P800 analyzer, Basel, Switzerland). The intra-assay and inter-assay coefficients of variation were <5%.

Fasting glucose level was measured by a double-antibody sandwich immunoassay (Elecsys 1010 analyzer, F. Hoffmann-La Roche Diagnostics, Mannheim, Germany). The intra-assay and inter-assay coefficients of variation were <5%.

Single nucleotide polymorphism Val66Met (rs6265) in brain-derived neurotropic factor gene determination

The DNA extraction was performed according to the protocol for a commercial set “TacMan TMSNP Genotyping Assays” (Thermo Fisher Scientific Assay IDC_11592758_1). The assessment of allelic states of SNP studied was performed using real-time polymerase chain reaction. Primers that we used in BDNF val66Met (rs6265) polymorphism assay were as follows: CCTACAGTTCCACCAGGTGAGAAGAGTG (forward) and TCATGGACATGTTTGCAGCATCTAGGTA (reverse).

Emotional status

All patients from final cohort had emotion changes of subclinical level and were examined by psychiatrist due to Diagnostic and Statistical Manual of Mental Disorders-5. Major depression was excluded from analysis. Emotional status of patients and their relationship with stress, depression, and anxiety were estimated due to “Depression, Anxiety and Stress-21” questionnaire. The level of anxiety 9 balls and higher, depression – more than 11 balls, and stress – more than 13 balls testified about exceeding the norm. Within 3 days after revascularization the patients were emotionally stable. The psychological status of STEMI patients were evaluated by physician at 10–14 day after STEMI.

Statistics

Statistical analyses were performed using SPSS for Windows v. 23 (IBM, Chicago, IL, USA). Continuous variables are presented as mean ± standard deviation when normally distributed or median and interquartile range if otherwise. Categorical variables are presented as frequencies (n) and percentages (%). Mann–Whitney and Wald–Wolfowitz criteria were used for intergroup differences and quantitative values. The qualitative variables are expressed as percentages and were compared with the Chi-square test and exact F Fisher test. Allele frequencies were estimated, and all polymorphisms were tested for Hardy–Weinberg Equilibrium. We performed univariate and multiple variate log-regression analysis to determine the factors that could predict late adverse cardiac remodeling at 6 months and combined endpoint. We calculated beta coefficient, standard errors, odds ratio, 95% confidence interval for each factor. Factors with P value >0.5 were not included in the multiple variate log-regression analysis. All differences were considered statistically significant with two-tailed P < 0.05.


  Results Top


General clinical characteristic of the patients enrolled in the study is reported in [Table 1]. The observed frequency of Val66Met BDNF genotypes In STEMI patients was as follows: 66ValVal - 74.2% and 66ValMet + 66MetMet - 25.8%. Genotypes frequency matched to Hardy–Weinberg equilibrium (χ2 = 0.17, P > 0.05). Patients with 66ValVal genotype and 66ValMet/66MetMet genotypes were not different in age, sex, glomerular filtration rate, CV risk factors, such as type 2 diabetes mellitus, hypertension, smoking, obesity, and HCE.
Table 1: Clinical characteristic of ST segment elevation myocardial infarction patients enrolled in the study depending on Val66Met polymorphism in brain-derived neurotropic factor gene

Click here to view


Patients with genotype 66ValVal in BDNF gene significantly more frequent represented right coronary artery injury (P = 0.0001) [Table 2]. Individuals with 66ValMet + 66MetMet genotype revealed more frequent incidences of HF (P =0.028), recurrent angina (P =0.023), and 6-month combined endpoints (P =0.004). We did not find significant differences between localization of acute MI, culprit coronary arteries, complications of acute period of STEMI.
Table 2: ST segment elevation myocardial infarction localization and injured coronary arteries depending on Val66Met polymorphism of brain-derived neurotropic factor gene

Click here to view


Patients with genotype 66ValMet + 66MetMet in BDNF gene had the highest E/e' at acute period and at 6 month of observation period (P = 0.01). After 6-month observation, values of LVEF, left atrial dimension, and left atrial volume were significantly different (P =0.008, P =0.0001 Ta P =0.002, respectively). It has been revealed significant differences between groups in SBP and DBP at baseline and at the end of study [Table 3].
Table 3: Hemodynamic of enrolled patients depending on Val66Met polymorphism of brain-derived neurotropic factor gene

Click here to view


Severity of depression according to depression scale was more profound in individuals with 66ValMet + 66MetMet polymorphysms in BDNF gene (P =0.045) than in patients with ValVal genotype [Table 4].
Table 4: Anxiety, depression, and stress during 10-14 day period before ST segment elevation myocardial infarction (Depression, Anxiety, and Stress Scale-21 questionnaire) depending on presentation of Val66Met polymorphism in brain-derived neurotropic factor gene

Click here to view


Univariate and multivariate linear regressions have shown that 66ValMet + 66MetMet genotype in BDNF gene, anxiety and stress prior to STEMI, LVEF were independent predictors for 6-month combined endpoint (P = 0.0395) [Table 5].
Table 5: The factors contributing to 6-month combined clinical end point after ST segment elevation myocardial infarction: The results of univariate and multivariate linear regressions

Click here to view


Kaplan–Meier curves demonstrated that STEMI patients with 66ValVal genotype in BDNF gene had a lower accumulation of combined endpoint compared with acute STEMI patients with 66ValMet + 66ValMet polymorphism (Cox-criterion, P =0.019; log-rang criterion, P =0.03) [Figure 3].
Figure 3: Kaplan–Meier curve accumulation of combined endpoint after 6 months' observation depending on polymorphism Val66Met in brain-derived neurotropic factor gene. First group = genotype 66ValVal, Second group = 66ValMet + 66MetMet

Click here to view



  Discussion Top


We found negative association between the 66ValMet + 66MetMet polymorphism in the BDNF gene and 6-month adverse clinical outcomes in STEMI patients after successful primary PCI. Previous studies have shown that BDNF improved survival of endothelial cells, smooth muscle cells and cardiac myocytes, as well as regulated angiogenesis through various autocrine and paracrine mechanisms.[17],[18],[19] There is evidence regarding that patients with acute coronary syndrome had reduced circulating BDNF levels. Decreasing BDNF can be explained by stress and hypercortisolemia that were associated with acute MI.[18],[19] In addition, BDNF is released by activated M1 and M2 types of macrophages and has cardioprotective effect, which is mediated by its influence on angiogenesis through promoting neovascularization and mobbing of endothelial cells via NF-kB receptors.[20] This proves the constitutive action of the BDNF-NF-kB bond to support myocardial function and angiogenesis, while the altered BDNF-NF-kB cooperation contributes to the development of myocardial injury and cardiac dysfunction.[21],[22],[23] Overall, the reduced level of BDNF in individuals with Met allele confirms this assumption.

The results of CATHGEN (CATHeterization GENetics) study that were based on the investigation of more than 5500 patients with coronary artery disease (CAD) and severe (≥75%) coronary stenosis have shown that the 66ValVal genotype BDNF gene was strongly associated with a severity of CAD and the occurrence of atherothrombotic events during 6 years of follow-up.[19] Another retrospective study has demonstrated that the 66MetMet genotype had a protective effect against the unstable angina and chronic myocardial ischemia.[23],[24],[25],[26]

On the other hand, the meta-analysis of 21,060 participants showed that the presence of stressful events from early childhood in conjunction with the Met allele independently leads to the development of depression.[27] In addition, carriers of the Met allele are more likely to suffer from depression with prolonged exposure to stressful environmental factors including ischemia. Interestingly, animal study has been reported that platelet activation, changes in the coagulation, and 66MetMet expression in the BDNF gene in vasculature were associated with a risk of anxiety and depression.[27] Moreover, Val66Met polymorphism can independently reflect an individual risk for arterial thrombosis and acute MI.[27] Therefore, the Met allele was able to correspond to increased risk of generalized anxiety disorder and major depression.[28],[29] Kang et al. evaluating the Val66Met BDNF gene polymorphism in 969 patients with acute coronary syndrome reported that the presence of depression in this population was significantly associated with the Met allele in the BDNF gene.[30] Another investigation has shown close association between Val66Met polymorphism in the BDNF gene and the reactivity of the hypothalamic–pituitary–adrenal axis to stress in healthy volunteers.[31] WE believe that the 66ValMet + 66MetMet polymorphism in the BDNF gene could associate with stress and anxiety and that this concordance in both factors is clinically important for STEMI patients because it relates to adverse long-term prognosis. It can be assumed that the 66ValMet + 66MetMet genotype in BDNF gene affects human homeostasis and contributes to a more pronounced effect of stressor factors including depression. This effect is manifested by the development of CV events in the future.


  Conclusion Top


We found that presentation of 66ValMet + 66MetMet polymorphism in BDNF gene is an independent predictor of combined 6-month endpoint in after acute STEMI-treated primary PCI.

Acknowledgments

There are no previous presentations of the information reported in the article. We thank Dr Nataliia Tytarenko and Dr Igor Polivenok for performing ultrasound examination and PCI, respectively. In addition, we thank, Galina Bugrimenko for her excellent technical assistance. Permission to acknowledge has been obtained.

Financial support and sponsorship

The study is a fragment of the research project: “To study the biochemical, genetic mechanisms of reperfusion damage of the myocardium and to assess the cardioprotective effect of antiplatelet therapy in acute myocardial infarction,” State Registration No. 0117U003028/Ukraine.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Vaccarino V, Badimon L, Bremner JD, Cenko E, Cubedo J, Dorobantu M, et al. Depression and coronary heart disease: 2018 ESC position paper of the working group of coronary pathophysiology and microcirculation developed under the auspices of the ESC committee for practice guidelines. Eur Heart J 2019. doi: 10.1093/eurheartj/ehy913.  Back to cited text no. 1
    
2.
Manni L, Nikolova V, Vyagova D, Chaldakov GN, Aloe L. Reduced plasma levels of NGF and BDNF in patients with acute coronary syndromes. Int J Cardiol 2005;102:169-71.  Back to cited text no. 2
    
3.
Jiang H, Liu Y, Zhang Y, Chen ZY. Association of plasma brain-derived neurotrophic factor and cardiovascular risk factors and prognosis in angina pectoris. Biochem Biophys Res Commun 2011;415:99-103.  Back to cited text no. 3
    
4.
Skaper SD. The neurotrophin family of neurotrophic factors: An overview. Methods Mol Biol 2012;846:1-2.  Back to cited text no. 4
    
5.
László A, Lénárt L, Illésy L, Fekete A, Nemcsik J. The role of neurotrophins in psychopathology and cardiovascular diseases: Psychosomatic connections. J Neural Transm (Vienna) 2019;126:265-78.  Back to cited text no. 5
    
6.
Emanueli C, Meloni M, Hasan W, Habecker BA. The biology of neurotrophins: Cardiovascular function. Handb Exp Pharmacol 2014;220:309-28.  Back to cited text no. 6
    
7.
Kermani P, Hempstead B. Brain-derived neurotrophic factor: A newly described mediator of angiogenesis. Trends Cardiovasc Med 2007;17:140-3.  Back to cited text no. 7
    
8.
Prigent-Tessier A, Quirié A, Maguin-Gaté K, Szostak J, Mossiat C, Nappey M, et al. Physical training and hypertension have opposite effects on endothelial brain-derived neurotrophic factor expression. Cardiovasc Res 2013;100:374-82.  Back to cited text no. 8
    
9.
Donovan MJ, Lin MI, Wiegn P, Ringstedt T, Kraemer R, Hahn R, et al. Brain derived neurotrophic factor is an endothelial cell survival factor required for intramyocardial vessel stabilization. Development 2000;127:4531-40.  Back to cited text no. 9
    
10.
Liu YQ, Su GB, Duan CH, Wang JH, Liu HM, Feng N, et al. Brainderived neurotrophic factor gene polymorphisms are associated with coronary artery diseaserelated depression and antidepressant response. Mol Med Rep 2014;10:3247-53.  Back to cited text no. 10
    
11.
Egan MF, Kojima M, Callicott JH, Goldberg TE, Kolachana BS, Bertolino A, et al. The BDNF Val66met polymorphism affects activity-dependent secretion of BDNF and human memory and hippocampal function. Cell 2003;112:257-69.  Back to cited text no. 11
    
12.
Ibanez B, James S, Agewall S, Antunes MJ, Bucciarelli-Ducci C, Bueno H, et al. 2017 ESC guidelines for the management of acute myocardial infarction in patients presenting with ST-segment elevation: The task force for the management of acute myocardial infarction in patients presenting with ST-segment elevation of the European Society of Cardiology (ESC). Eur Heart J 2018;39:119-77.  Back to cited text no. 12
    
13.
Kirby A, Gebski V, Keech AC. Determining the sample size in a clinical trial. Med J Aust 2002;177:256-7.  Back to cited text no. 13
    
14.
Authors/Task Force Members:, Catapano AL, Graham I, De Backer G, Wiklund O, Chapman MJ, et al. 2016 ESC/EAS guidelines for the management of dyslipidaemias: The task force for the management of dyslipidaemias of the European Society of Cardiology (ESC) and European Atherosclerosis Society (EAS) developed with the special contribution of the European Association for Cardiovascular Prevention and Rehabilitation (EACPR). Atherosclerosis 2016;253:281-344.  Back to cited text no. 14
    
15.
Williams B, Mancia G, Spiering W, Agabiti Rosei E, Azizi M, Burnier M, et al. 2018 ESC/ESH guidelines for the management of arterial hypertension. Eur Heart J 2018;39:3021-104.  Back to cited text no. 15
    
16.
Ponikowski P, Voors AA, Anker SD, Bueno H, Cleland JG, Coats AJ, et al. 2016 ESC guidelines for the diagnosis and treatment of acute and chronic heart failure: The task force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC). Developed with the special contribution of the Heart Failure Association (HFA) of the ESC. Eur J Heart Fail 2016;18:891-975.  Back to cited text no. 16
    
17.
Caporali A, Emanueli C. Cardiovascular actions of neurotrophins. Physiol Rev 2009;89:279-308.  Back to cited text no. 17
    
18.
Taşçı İ, Kabul HK, Aydoǧdu A. Brain derived neurotrophic factor (BDNF) in cardiometabolic physiology and diseases. Anadolu Kardiyol Derg 2012;12:684-8.  Back to cited text no. 18
    
19.
Jiang R, Babyak MA, Brummett BH, Hauser ER, Shah SH, Becker RC, et al. Brain-derived neurotrophic factor rs6265 (Val66Met) polymorphism is associated with disease severity and incidence of cardiovascular events in a patient cohort. Am Heart J 2017;190:40-5.  Back to cited text no. 19
    
20.
Hong JH, Park HM, Byun KH, Lee BH, Kang WC, Jeong GB, et al. BDNF expression of macrophages and angiogenesis after myocardial infarction. Int J Cardiol 2014;176:1405-8.  Back to cited text no. 20
    
21.
Feng N, Huke S, Zhu G, Tocchetti CG, Shi S, Aiba T, et al. Constitutive BDNF/TrkB signaling is required for normal cardiac contraction and relaxation. Proc Natl Acad Sci U S A 2015;112:1880-5.  Back to cited text no. 21
    
22.
Okada S, Yokoyama M, Toko H, Tateno K, Moriya J, Shimizu I, et al. Brain-derived neurotrophic factor protects against cardiac dysfunction after myocardial infarction via a central nervous system-mediated pathway. Arterioscler Thromb Vasc Biol 2012;32:1902-9.  Back to cited text no. 22
    
23.
Halade GV, Ma Y, Ramirez TA, Zhang J, Dai Q, Hensler JG, et al. Reduced BDNF attenuates inflammation and angiogenesis to improve survival and cardiac function following myocardial infarction in mice. Am J Physiol Heart Circ Physiol 2013;305:H1830-42.  Back to cited text no. 23
    
24.
Jiang H, Wang R, Liu Y, Zhang Y, Chen ZY. BDNF Val66Met polymorphism is associated with unstable angina. Clin Chim Acta 2009;400:3-7.  Back to cited text no. 24
    
25.
Bozzini S, Gambelli P, Boiocchi C, Schirinzi S, Falcone R, Buzzi P, et al. Coronary artery disease and depression: Possible role of brain-derived neurotrophic factor and serotonin transporter gene polymorphisms. Int J Mol Med 2009;24:813-8.  Back to cited text no. 25
    
26.
Zhao M, Chen L, Yang J, Han D, Fang D, Qiu X, et al. BDNF Val66Met polymorphism, life stress and depression: A meta-analysis of gene-environment interaction. J Affect Disord 2018;227:226-35.  Back to cited text no. 26
    
27.
Amadio P, Colombo GI, Tarantino E, Gianellini S, Ieraci A, Brioschi M, et al. BDNFVal66met polymorphism: A potential bridge between depression and thrombosis. Eur Heart J 2017;38:1426-35.  Back to cited text no. 27
    
28.
González-Castro TB, Salas-Magaña M, Juárez-Rojop IE, López-Narváez ML, Tovilla-Zárate CA, Hernández-Díaz Y, et al. Exploring the association between BDNF Val66Met polymorphism and suicidal behavior: Meta-analysis and systematic review. J Psychiatr Res 2017;94:208-17.  Back to cited text no. 28
    
29.
Aldoghachi AF, Tor YS, Redzun SZ, Lokman KA, Razaq NA, Shahbudin AF, et al. Screening of brain-derived neurotrophic factor (BDNF) single nucleotide polymorphisms and plasma BDNF levels among Malaysian major depressive disorder patients. PLoS One 2019;14:e0211241.  Back to cited text no. 29
    
30.
Kang HJ, Bae KY, Kim SW, Shin IS, Hong YJ, Ahn Y, et al. BDNF Val66met polymorphism and depressive disorders in patients with acute coronary syndrome. J Affect Disord 2016;194:1-8.  Back to cited text no. 30
    
31.
Alexander N, Osinsky R, Schmitz A, Mueller E, Kuepper Y, Hennig J, et al. The BDNF Val66Met polymorphism affects HPA-axis reactivity to acute stress. Psychoneuroendocrinology 2010;35:949-53.  Back to cited text no. 31
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]


This article has been cited by
1 Myokines and Heart Failure: Challenging Role in Adverse Cardiac Remodeling, Myopathy, and Clinical Outcomes
Alexander E. Berezin,Alexander A. Berezin,Michael Lichtenauer,Robert Pichler
Disease Markers. 2021; 2021: 1
[Pubmed] | [DOI]
2 Depression and Cardiovascular Disease: The Viewpoint of Platelets
Patrizia Amadio,Marta Zarą,Leonardo Sandrini,Alessandro Ieraci,Silvia Stella Barbieri
International Journal of Molecular Sciences. 2020; 21(20): 7560
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed2940    
    Printed153    
    Emailed0    
    PDF Downloaded196    
    Comments [Add]    
    Cited by others 2    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]